After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MAPK10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009158.2
Размер кДНК:1269bp
Описание кДНК:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 10 with C terminal His tag.
Синоним гена:JNK3, Serk2, JNK3B1, JNK3B2, p493F12, p54bSAPK, SAPK(beta), C230008H04Rik, Mapk10
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51077-ACGRBS15400
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51077-ACRRBS15400
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51077-ANGRBS15400
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51077-ANRRBS15400
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51077-CFRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51077-CHRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51077-CMRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51077-CYRBS13340
Мышь MAPK10/JNK3 Джин клон кДНК в вектор клонированияMG51077-GRBS5130
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51077-NFRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51077-NHRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51077-NMRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51077-NYRBS13340
Мышь MAPK10/JNK3 Джин ORF экспрессии кДНК клона плазмидыMG51077-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51077-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».