Быстрый заказ

Text Size:AAA

Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MAP2K2 Информация о продукте «Клон cDNA»
Размер кДНК:1206bp
Описание кДНК:Full length Clone DNA of Mus musculus mitogen-activated protein kinase kinase 2 with C terminal Myc tag.
Синоним гена:MK2, MEK2, Prkmk2, AA589381
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50338-ACGRBS15400
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50338-ACRRBS15400
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50338-ANGRBS15400
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50338-ANRRBS15400
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50338-CFRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50338-CHRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50338-CMRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50338-CYRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин клон кДНК в вектор клонированияMG50338-GRBS5130
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50338-NFRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50338-NHRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50338-NMRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50338-NYRBS13340
Мышь MEK2/MAP2K2/MKK2 Джин ORF экспрессии кДНК клона плазмидыMG50338-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    Каталог: MG50338-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.