Быстрый заказ

Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь MAGED1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_019791.2
    Размер кДНК:2328bp
    Описание кДНК:Full length Clone DNA of Mus musculus melanoma antigen, family D, 1 with N terminal His tag.
    Синоним гена:NRAGE; Dlixin; Dlxin1; Dlxin-1; MAGE-D1; mFLJ00163; DXBwg1492e; 2810433C11Rik; 5430405L04Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MAGED1 qPCR primers for gene expression analysis, MP201269 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51399-ACGRBS16760
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51399-ACRRBS16760
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51399-ANGRBS16760
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51399-ANRRBS16760
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51399-CFRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51399-CHRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51399-CMRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51399-CYRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51399-NFRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51399-NHRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51399-NMRBS14710
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51399-NYRBS14710
    Мышь MAGED1 Джин клон кДНК в вектор клонированияMG51399-URBS5130
    Мышь MAGED1 Джин ORF экспрессии кДНК клона плазмидыMG51399-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51399-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».