Быстрый заказ

Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MAG Информация о продукте «Клон cDNA»
Размер кДНК:1749bp
Описание кДНК:Full length Clone DNA of Mus musculus myelin-associated glycoprotein with N terminal His tag.
Синоним гена:Gma, siglec-4a
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51398-ACGRBS16760
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51398-ACRRBS16760
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51398-CFRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51398-CHRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51398-CMRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51398-CYRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51398-NFRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51398-NHRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51398-NMRBS14710
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51398-NYRBS14710
Мышь MAG/GMA/Siglec-4 Джин клон кДНК в вектор клонированияMG51398-URBS5130
Мышь MAG/GMA/Siglec-4 Джин ORF экспрессии кДНК клона плазмидыMG51398-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 100kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.

  • Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.
  • Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.
  • Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.