LYVE1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

LYVE1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Mouse lymphatic vessel endothelial hyaluronan receptor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LYVE1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

1200012G08Rik cDNA ORF Clone, Mouse; Crsbp-1 cDNA ORF Clone, Mouse; Lyve-1 cDNA ORF Clone, Mouse; Xlkd1 cDNA ORF Clone, Mouse

LYVE1 Background Information

LYVE1, also known as LYVE-1, is a type I integral membrane glycoprotein. It contains 1 Link domain and mainly expressed in endothelial cells lining lymphatic vessels. LYVE1 acts as a receptor and binds to both soluble and immobilized hyaluronan. It may function in lymphatic hyaluronan transport and have a role in tumor metastasis. LYVE1 also is a cell surface receptor on lymphatic endothelial cells that can be used as a lymphatic endothelial cell marker, and sort these cells for experimental purposes. It also functions as a ligand-specific transporter trafficking between intracellular organelles and the plasma membrane. It plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding. It may act as an hyaluronan transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.
Full Name
lymphatic vessel endothelial hyaluronan receptor 1
References
  • Jackson DG. (2003) The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med. 13(1):1-7.
  • Banerji S, et al. (1999) LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol. 144(4):789-801.
  • Mouta Carreira C, et al. (2001) LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis. Cancer Res. 61(22): 8079-84.
  • Cursiefen C, et al. (2002) Lymphatic vessels in vascularized human corneas: immunohistochemical investigation using LYVE-1 and podoplanin. Invest Ophthalmol Vis Sci. 43(7):2127-35.
Add to Cart Successfully Add to Cart Failed