Быстрый заказ

Text Size:AAA

Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LTF Информация о продукте «Клон cDNA»
Размер кДНК:2124bp
Описание кДНК:Full length Clone DNA of Mus musculus lactotransferrin with N terminal His tag.
Синоним гена:Lf, Csp82, Ms10r, MMS10R, Ltf
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50750-ACGRBS16760
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50750-ACRRBS16760
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50750-CFRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50750-CHRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50750-CMRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50750-CYRBS14710
Мышь Lactotransferrin/LTF Джин клон кДНК в вектор клонированияMG50750-GRBS5130
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50750-NFRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50750-NHRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50750-NMRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50750-NYRBS14710
Мышь Lactotransferrin/LTF Джин ORF экспрессии кДНК клона плазмидыMG50750-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe3+ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.

  • Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.
  • Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.
  • Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.
  • Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.
  • Size / Price
    Каталог: MG50750-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.