Быстрый заказ

Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LTA4H Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008517.2
Размер кДНК:1836bp
Описание кДНК:Full length Clone DNA of Mus musculus leukotriene A4 hydrolase.
Синоним гена:Lta4h
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50268-ACGRBS16760
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50268-ACRRBS16760
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50268-ANGRBS16760
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50268-ANRRBS16760
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50268-CFRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50268-CHRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50268-CMRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50268-CYRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин клон кДНК в вектор клонированияMG50268-MRBS5130
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50268-NFRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50268-NHRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50268-NMRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50268-NYRBS14710
Мышь Leukotriene A4 Hydrolase/LTA4H Джин ORF экспрессии кДНК клона плазмидыMG50268-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

Ссылки
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Size / Price
    Каталог: MG50268-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».