After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LRPAP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013587.2
Размер кДНК:1083bp
Описание кДНК:Full length Clone DNA of Mus musculus low density lipoprotein receptor-related protein associated protein 1.
Синоним гена:RAP, HBP44, C77774, AA617339, AI790446, AU042172, Lrpap1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50281-ACGRBS15400
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50281-ACRRBS15400
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50281-ANGRBS15400
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50281-ANRRBS15400
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50281-CFRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50281-CHRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50281-CMRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50281-CYRBS13340
Мышь LRPAP1/A2MRAP Джин клон кДНК в вектор клонированияMG50281-MRBS5130
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50281-NFRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50281-NHRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50281-NMRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50281-NYRBS13340
Мышь LRPAP1/A2MRAP Джин ORF экспрессии кДНК клона плазмидыMG50281-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 330), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).

Ссылки
  • Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.
  • Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?
  • Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.
  • Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.
  • Size / Price
    Каталог: MG50281-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».