After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LIFR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013584.2
Размер кДНК:3279bp
Описание кДНК:Full length Clone DNA of Mus musculus leukemia inhibitory factor receptor with C terminal Flag tag.
Синоним гена:LIF, AW061234, A230075M04Rik, Lifr
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50423-ACGRBS22240
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50423-ACRRBS22240
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50423-CFRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50423-CHRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50423-CMRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50423-CYRBS20190
Мышь LIFR/CD118 Джин клон кДНК в вектор клонированияMG50423-MRBS5130
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50423-M-HRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50423-NFRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50423-NHRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50423-NMRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50423-NYRBS20190
Мышь LIFR/CD118 Джин ORF экспрессии кДНК клона плазмидыMG50423-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

Ссылки
  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • Size / Price
    Каталог: MG50423-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».