After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LIAS Информация о продукте «Клон cDNA»
Размер кДНК:1122bp
Описание кДНК:Full length Clone DNA of Mus musculus lipoic acid synthetase with C terminal His tag.
Синоним гена:7a5ex; mLip1; C77512; 2900022L22Rik; 4933425M12Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51718-ACGRBS15400
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51718-ACRRBS15400
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51718-ANGRBS15400
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51718-ANRRBS15400
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51718-CFRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51718-CHRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51718-CMRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51718-CYRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51718-NFRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51718-NHRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51718-NMRBS13340
Мышь LIAS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51718-NYRBS13340
Мышь LIAS Джин клон кДНК в вектор клонированияMG51718-URBS5130
Мышь LIAS Джин ORF экспрессии кДНК клона плазмидыMG51718-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51718-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.