Быстрый заказ

Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь LGALS9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_010708.2
    Размер кДНК:1062bp
    Описание кДНК:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 9 with C terminal Flag tag.
    Синоним гена:gal-9, Lgals5, LGALS35, AA407335, AI194909, AI265545, galectin-9
    Виды:Mouse
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGALS9 qPCR primers for gene expression analysis, MP200434 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50424-ACGRBS15400
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50424-ACRRBS15400
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50424-CFRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50424-CHRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50424-CMRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50424-CYRBS13340
    Мышь Galectin-9/LGALS9 Джин клон кДНК в вектор клонированияMG50424-MRBS5130
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50424-NFRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50424-NHRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50424-NMRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50424-NYRBS13340
    Мышь Galectin-9/LGALS9 Джин ORF экспрессии кДНК клона плазмидыMG50424-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Size / Price
    Каталог: MG50424-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».