Galectin 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

Galectin 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
411 bp
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 7 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

Galectin-7 cDNA ORF Clone, Mouse; Pig1 cDNA ORF Clone, Mouse

Galectin 7 Background Information

LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of beta-galactoside-binding proteins. There are at least 14 identified members in this family. Galectins share similarities in the CRD (the carbohydrate recognition domain). They are synthesized as cytosolic proteins. Though localized principally in the cytoplasm and lacking a classical signal peptide, galectins can also be stimulated to secretion by non-classical pathways or alternatively targeted to the nucleus. Galectins are implicated in modulating cell-cell and cell-matrix interactions. LGALS7 contains 1 galectin domain and is mainly expressed in stratified squamous epithelium. Galectin-7 could be involved in cell-cell and/or cell-matrix interactions necessary for normal growth control. LGALS7 is a pro-apoptotic protein that functions intracellularly upstream of JNK activation and cytochrome c release.
Full Name
lectin, galactoside-binding, soluble, 7
References
  • Villeneuve C, et al. (2011) Mitochondrial proteomic approach reveals galectin-7 as a novel BCL-2 binding protein in human cells. Mol Biol Cell. 22(7):999-1013.
  • Rondanino C, et al. (2011) Galectin-7 modulates the length of the primary cilia and wound repair in polarized kidney epithelial cells. Am J Physiol Renal Physiol. 301(3):F622-33.
  • Masuyer G, et al. (2012) Inhibition mechanism of human galectin-7 by a novel galactose-benzylphosphate inhibitor. FEBS J. 279(2):193-202.
  • Magnaldo T, et al. (1995) Galectin-7, a human 14-kDa S-lectin, specifically expressed in keratinocytes and sensitive to retinoic acid. Dev Biol. 168(2):259-71.
  • Madsen P, et al. (1995) Cloning, expression, and chromosome mapping of human galectin-7. J Biol Chem. 270(11):5823-29.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait