Быстрый заказ

Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь LGALS7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_008496.4
    Размер кДНК:411bp
    Описание кДНК:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 7 with C terminal Flag tag.
    Синоним гена:MGC151215, MGC151217, Galectin-7, Lgals7
    Виды:Mouse
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGALS7 qPCR primers for gene expression analysis, MP200421 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50404-ACGRBS15400
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50404-ACRRBS15400
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50404-CFRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50404-CHRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50404-CMRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50404-CYRBS13340
    Мышь LGALS7 / Galectin-7 Джин клон кДНК в вектор клонированияMG50404-MRBS5130
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50404-NFRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50404-NHRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50404-NMRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50404-NYRBS13340
    Мышь LGALS7 / Galectin-7 Джин ORF экспрессии кДНК клона плазмидыMG50404-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of beta-galactoside-binding proteins. There are at least 14 identified members in this family. Galectins share similarities in the CRD (the carbohydrate recognition domain). They are synthesized as cytosolic proteins. Though localized principally in the cytoplasm and lacking a classical signal peptide, galectins can also be stimulated to secretion by non-classical pathways or alternatively targeted to the nucleus. Galectins are implicated in modulating cell-cell and cell-matrix interactions. LGALS7 contains 1 galectin domain and is mainly expressed in stratified squamous epithelium. Galectin-7 could be involved in cell-cell and/or cell-matrix interactions necessary for normal growth control. LGALS7 is a pro-apoptotic protein that functions intracellularly upstream of JNK activation and cytochrome c release.

    Ссылки
  • Villeneuve C, et al. (2011) Mitochondrial proteomic approach reveals galectin-7 as a novel BCL-2 binding protein in human cells. Mol Biol Cell. 22(7):999-1013.
  • Rondanino C, et al. (2011) Galectin-7 modulates the length of the primary cilia and wound repair in polarized kidney epithelial cells. Am J Physiol Renal Physiol. 301(3):F622-33.
  • Masuyer G, et al. (2012) Inhibition mechanism of human galectin-7 by a novel galactose-benzylphosphate inhibitor. FEBS J. 279(2):193-202.
  • Magnaldo T, et al. (1995) Galectin-7, a human 14-kDa S-lectin, specifically expressed in keratinocytes and sensitive to retinoic acid. Dev Biol. 168(2):259-71.
  • Madsen P, et al. (1995) Cloning, expression, and chromosome mapping of human galectin-7. J Biol Chem. 270(11):5823-29.
  • Size / Price
    Каталог: MG50404-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».