After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LGALS4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010706.1
Размер кДНК:981bp
Описание кДНК:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 4 with C terminal Flag tag.
Синоним гена:galectin-4, Lgals4
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-mLGALS4-flag
Участок рестрикции:KpnI + XbaI (6kb + 1.02kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse LGALS4 Gene Plasmid Map
Mouse LGALS4 ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50426-ACGRBS15400
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50426-ACRRBS15400
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50426-ANGRBS15400
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50426-ANRRBS15400
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50426-CFRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50426-CHRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50426-CMRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50426-CYRBS13340
Мышь Galectin-4/LGALS4 Джин клон кДНК в вектор клонированияMG50426-MRBS5130
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50426-NFRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50426-NHRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50426-NMRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50426-NYRBS13340
Мышь Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмидыMG50426-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50426-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Mouse LGALS4 ORF mammalian expression plasmid, C-Flag tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».