Galectin 3 / LGALS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

Galectin 3 / LGALS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T/C,132C/T,141A/G,186C/T,546G/A,627C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+0.83kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin 3 / LGALS3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin 3 / LGALS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Validated Images

Galectin 3 / LGALS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

gal3 cDNA ORF Clone, Mouse; GBP cDNA ORF Clone, Mouse; L-34 cDNA ORF Clone, Mouse; Mac-2 cDNA ORF Clone, Mouse

Galectin 3 / LGALS3 Background Information

LGALS3, a member of the lectin family, has an important role in tumor progression through inhibition of apoptosis.The galectin-3 gene (LGALS3) encodes a beta-galactose binding lectin. LGALS3 expression is associated with neoplastic transformation and with differentiation of monocytes to macrophages. Galectin-3 is a beta-galactoside-binding lectin which is involved in modulating inflammation and apoptosis. Elevated expression of galectin-3 has been demonstrated in synovium of rheumatoid arthritis (RA).
Full Name
lectin, galactoside-binding, soluble, 3
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait