After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LGALS3 Информация о продукте «Клон cDNA»
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 3 with C terminal Flag tag.
Синоним гена:GBP, L-34, gal3, Mac-2, Lgals3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50406-ACGRBS15400
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50406-ACRRBS15400
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50406-ANGRBS15400
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50406-ANRRBS15400
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50406-CFRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50406-CHRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50406-CMRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50406-CYRBS13340
Мышь LGALS3 Джин клон кДНК в вектор клонированияMG50406-MRBS5130
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50406-NFRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50406-NHRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50406-NMRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50406-NYRBS13340
Мышь LGALS3 Джин ORF экспрессии кДНК клона плазмидыMG50406-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Size / Price
    Каталог: MG50406-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.