Lipocalin-2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50060-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Lipocalin-2 Reagents

CRO Services

Product recommended


All Lipocalin-2 Reagents

Lipocalin-2 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Mouse lipocalin 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lipocalin-2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

24p3 cDNA ORF Clone, Mouse;AW212229 cDNA ORF Clone, Mouse;Sip24 cDNA ORF Clone, Mouse

Lipocalin-2 Background Information

Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.
Full Name
lipocalin 2
References
  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
  • Lipocalin-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Lipocalin-2 cDNA ORF Clone in Cloning Vector, Rat RG80058-M
    Lipocalin-2 cDNA ORF Clone, Rat, untagged RG80058-UT
    Lipocalin-2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80058-ACG
    Lipocalin-2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80058-ACGLN
    Lipocalin-2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80058-ACR
    Lipocalin-2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80058-CF
    Lipocalin-2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80058-NF
    Lipocalin-2 cDNA ORF Clone, Rat, C-His tag RG80058-CH
    Lipocalin-2 cDNA ORF Clone, Rat, N-His tag RG80058-NH
    Lipocalin-2 cDNA ORF Clone, Rat, C-HA tag RG80058-CY
    Lipocalin-2 cDNA ORF Clone, Rat, N-HA tag RG80058-NY
    Lipocalin-2 cDNA ORF Clone, Rat, C-Myc tag RG80058-CM
    Lipocalin-2 cDNA ORF Clone, Rat, N-Myc tag RG80058-NM
    Lipocalin-2 qPCR Primer Pairs, Rat RP300056

    Lipocalin-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Lipocalin-2 cDNA ORF Clone in Cloning Vector, Mouse MG50060-G
    Lipocalin-2 cDNA ORF Clone, Mouse, untagged MG50060-UT
    Lipocalin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50060-ACGLN
    Lipocalin-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50060-ACG
    Lipocalin-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50060-ACR
    Lipocalin-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50060-CF
    Lipocalin-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50060-NF
    Lipocalin-2 cDNA ORF Clone, Mouse, C-His tag MG50060-CH
    Lipocalin-2 cDNA ORF Clone, Mouse, N-His tag MG50060-NH
    Lipocalin-2 cDNA ORF Clone, Mouse, C-HA tag MG50060-CY
    Lipocalin-2 cDNA ORF Clone, Mouse, N-HA tag MG50060-NY
    Lipocalin-2 cDNA ORF Clone, Mouse, C-Myc tag MG50060-CM
    Lipocalin-2 qPCR Primer Pairs, Mouse MP200060

    Lipocalin-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Lipocalin-2 cDNA ORF Clone in Cloning Vector, Human HG10222-M
    Lipocalin-2 cDNA ORF Clone, Human, untagged HG10222-UT
    Lipocalin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10222-ACG
    Lipocalin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10222-ACGLN
    Lipocalin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10222-ACR
    Lipocalin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10222-CF
    Lipocalin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10222-NF
    Lipocalin-2 cDNA ORF Clone, Human, C-His tag HG10222-CH
    Lipocalin-2 cDNA ORF Clone, Human, N-His tag HG10222-NH
    Lipocalin-2 cDNA ORF Clone, Human, C-HA tag HG10222-CY
    Lipocalin-2 cDNA ORF Clone, Human, N-HA tag HG10222-NY
    Lipocalin-2 cDNA ORF Clone, Human, C-Myc tag HG10222-CM
    Lipocalin-2 cDNA ORF Clone, Human, N-Myc tag HG10222-NM
    Lipocalin-2 qPCR Primer Pairs, Human HP100277
    info info
    添加购物车成功! 添加购物车失败!