LAMP3 / CD208 cDNA ORF Clone, Mouse, N-Myc tag

1/1
Price:
Size:
Number:

LAMP3 / CD208 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lysosomal-associated membrane protein 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.33kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LAMP3 / CD208 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAMP3 / CD208 cDNA ORF Clone, Mouse, N-Myc tag: Validated Images

LAMP3 / CD208 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

1200002D17Rik cDNA ORF Clone, Mouse; Cd208 cDNA ORF Clone, Mouse; DC-LAMP cDNA ORF Clone, Mouse; DCLAMP cDNA ORF Clone, Mouse; LAMP cDNA ORF Clone, Mouse; TSC403 cDNA ORF Clone, Mouse

LAMP3 / CD208 Background Information

Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD28, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm18, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.
Full Name
lysosomal associated membrane protein 3
References
  • Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.
  • Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.
  • Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.
Add to Cart Successfully Add to Cart Failed