LAMP2 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

LAMP2 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Mouse lysosomal-associated membrane protein 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LAMP2 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

CD107b cDNA ORF Clone, Mouse; Lamp-2 cDNA ORF Clone, Mouse; Lamp-2a cDNA ORF Clone, Mouse; Lamp-2b cDNA ORF Clone, Mouse; Lamp-2c cDNA ORF Clone, Mouse; LampII cDNA ORF Clone, Mouse; LGP-B cDNA ORF Clone, Mouse; Mac3 cDNA ORF Clone, Mouse

LAMP2 Background Information

LAMP2 (Lysosomal-associated membrane protein 2), also known as CD17b (Cluster of Differentiation 17b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.
Full Name
lysosomal-associated membrane protein 2
References
  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait