After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse LAMP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001017959.1
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Mus musculus lysosomal-associated membrane protein 2 with N terminal Myc tag.
Синоним гена:Mac3, CD107b, Lamp-2, Lamp-2a, Lamp-2b, Lamp-2c, Lamp2
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50791-ACGRBS15400
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50791-ACRRBS15400
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50791-CFRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50791-CHRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50791-CMRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50791-CYRBS13340
Мышь LAMP2/CD107b Джин клон кДНК в вектор клонированияMG50791-GRBS5130
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50791-NFRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50791-NHRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50791-NMRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50791-NYRBS13340
Мышь LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмидыMG50791-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

Ссылки
  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • Size / Price
    Каталог: MG50791-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».