After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KLHL36 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_146219.1
Размер кДНК:1842bp
Описание кДНК:Full length Clone DNA of Mus musculus kelch-like 36 with N terminal His tag.
Синоним гена:Klhl36
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51973-ACGRBS16760
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51973-ACRRBS16760
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51973-ANGRBS16760
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51973-ANRRBS16760
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51973-CFRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51973-CHRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51973-CMRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51973-CYRBS14710
Мышь C16orf44/KLHL36 Джин клон кДНК в вектор клонированияMG51973-GRBS5130
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51973-NFRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51973-NHRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51973-NMRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51973-NYRBS14710
Мышь C16orf44/KLHL36 Джин ORF экспрессии кДНК клона плазмидыMG51973-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51973-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».