After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KLHDC4 Информация о продукте «Клон cDNA»
Размер кДНК:1755bp
Описание кДНК:Full length Clone DNA of Mus musculus kelch domain containing 4 with N terminal HA tag.
Синоним гена:AA408426, AV352552, BC012312, G430025P05Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52008-ACGRBS16760
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52008-ACRRBS16760
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52008-ANGRBS16760
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52008-ANRRBS16760
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52008-CFRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52008-CHRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52008-CMRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52008-CYRBS14710
Мышь KLHDC4 Джин клон кДНК в вектор клонированияMG52008-GRBS5130
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52008-NFRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52008-NHRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52008-NMRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52008-NYRBS14710
Мышь KLHDC4 Джин ORF экспрессии кДНК клона плазмидыMG52008-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52008-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.