Быстрый заказ

Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KLHDC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027117.3
Размер кДНК:1221bp
Описание кДНК:Full length Clone DNA of Mus musculus kelch domain containing 2 with N terminal His tag.
Синоним гена:LCP, HCLP-1, D12Ertd522e, 2310022K15Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51979-ACGRBS15400
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51979-ACRRBS15400
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51979-ANGRBS15400
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51979-ANRRBS15400
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51979-CFRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51979-CHRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51979-CMRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51979-CYRBS13340
Мышь KLHDC2 Джин клон кДНК в вектор клонированияMG51979-GRBS5130
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51979-NFRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51979-NHRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51979-NMRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51979-NYRBS13340
Мышь KLHDC2 Джин ORF экспрессии кДНК клона плазмидыMG51979-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51979-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».