After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KIRREL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_130867.2
Размер кДНК:2370bp
Описание кДНК:Full length Clone DNA of Mus musculus kin of IRRE like (Drosophila) with N terminal Myc tag.
Синоним гена:Neph1, Kirrel1, Kirrel
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50193-ACGRBS16760
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50193-ACRRBS16760
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50193-CFRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50193-CHRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50193-CMRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50193-CYRBS14710
Мышь KIRREL1/NEPH1 Джин клон кДНК в вектор клонированияMG50193-MRBS5130
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50193-NFRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50193-NHRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50193-NMRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50193-NYRBS14710
Мышь KIRREL1/NEPH1 Джин ORF экспрессии кДНК клона плазмидыMG50193-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

Ссылки
  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    Каталог: MG50193-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».