Быстрый заказ

Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь KEL Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032540.3
    Размер кДНК:2142bp
    Описание кДНК:Full length Clone DNA of Mus musculus Kell blood group with C terminal His tag.
    Синоним гена:Ece3, CD238, MGC107471, Kel
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KEL qPCR primers for gene expression analysis, MP200459 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50452-ACGRBS16760
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50452-ACRRBS16760
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50452-CFRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50452-CHRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50452-CMRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50452-CYRBS14710
    Мышь Kell/Blood Group Kell Джин клон кДНК в вектор клонированияMG50452-MRBS5130
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50452-NFRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50452-NHRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50452-NMRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50452-NYRBS14710
    Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмидыMG50452-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG50452-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».