Быстрый заказ

Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KEL Информация о продукте «Клон cDNA»
Размер кДНК:2142bp
Описание кДНК:Full length Clone DNA of Mus musculus Kell blood group with C terminal His tag.
Синоним гена:Ece3, CD238, MGC107471, Kel
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50452-ACGRBS16764
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50452-ACRRBS16764
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50452-CFRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50452-CHRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50452-CMRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50452-CYRBS14711
Мышь Kell/Blood Group Kell Джин клон кДНК в вектор клонированияMG50452-MRBS5132
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50452-NFRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50452-NHRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50452-NMRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50452-NYRBS14711
Мышь Kell/Blood Group Kell Джин ORF экспрессии кДНК клона плазмидыMG50452-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50452-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.