KEG1/Hp33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

KEG1/Hp33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Mouse kidney expressed gene 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KEG1/Hp33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

0610008P16Rik cDNA ORF Clone, Mouse; AI316519 cDNA ORF Clone, Mouse; GS4059 cDNA ORF Clone, Mouse

KEG1/Hp33 Background Information

Full Name
kidney expressed gene 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait