After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse KDM1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133872.2
Размер кДНК:2562bp
Описание кДНК:Full length Clone DNA of Mus musculus lysine (K)-specific demethylase 1A with N terminal His tag.
Синоним гена:Aof2, Kdm1, Lsd1, AA408884, mKIAA0601, D4Ertd478e, 1810043O07Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51985-ACGRBS22240
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51985-ACRRBS22240
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51985-ANGRBS22240
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51985-ANRRBS22240
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51985-CFRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51985-CHRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51985-CMRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51985-CYRBS20190
Мышь LSD1 Джин клон кДНК в вектор клонированияMG51985-GRBS5130
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51985-NFRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51985-NHRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51985-NMRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51985-NYRBS20190
Мышь LSD1 Джин ORF экспрессии кДНК клона плазмидыMG51985-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me0 through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.

Ссылки
  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
  • Size / Price
    Каталог: MG51985-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».