Быстрый заказ

Text Size:AAA

Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse JTB Информация о продукте «Клон cDNA»
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Mus musculus jumping translocation breakpoint with C terminal Myc tag.
Синоним гена:Gm622
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52774-ACGRBS15400
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52774-ACRRBS15400
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52774-CFRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52774-CHRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52774-CMRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52774-CYRBS13340
Мышь jumping translocation breakpoint / JTB Джин клон кДНК в вектор клонированияMG52774-GRBS5130
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52774-NFRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52774-NHRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52774-NMRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52774-NYRBS13340
Мышь jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмидыMG52774-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Каталог: MG52774-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.