Быстрый заказ

Text Size:AAA

Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse JAM2 Информация о продукте «Клон cDNA»
Размер кДНК:897bp
Описание кДНК:Full length Clone DNA of Mus musculus junction adhesion molecule 2 with N terminal Flag tag.
Синоним гена:JAM-2, JAM-B, Jcam2, VE-JAM, AU016127, 1110002N23Rik, 2410030G21Rik, 2410167M24Rik, Jam2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50464-ACGRBS15400
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50464-ACRRBS15400
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50464-CFRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50464-CHRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50464-CMRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50464-CYRBS13340
Мышь Junctional Adhesion Molecule B Джин клон кДНК в вектор клонированияMG50464-MRBS5130
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50464-NFRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50464-NHRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50464-NMRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50464-NYRBS13340
Мышь Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмидыMG50464-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Каталог: MG50464-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.