Быстрый заказ

Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь JAKMIP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_178394.4
    Размер кДНК:1881bp
    Описание кДНК:Full length Clone DNA of Mus musculus janus kinase and microtubule interacting protein 1.
    Синоним гена:Gababrbp, Marlin-1, 5830437M04Rik, C330021K24Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with JAKMIP1 qPCR primers for gene expression analysis, MP201247 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51374-ACGRBS16760
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51374-ACRRBS16760
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51374-ANGRBS16760
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51374-ANRRBS16760
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51374-CFRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51374-CHRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51374-CMRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51374-CYRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51374-NFRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51374-NHRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51374-NMRBS14710
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51374-NYRBS14710
    Мышь JAKMIP1 Джин клон кДНК в вектор клонированияMG51374-URBS5130
    Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмидыMG51374-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51374-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».