After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse JAKMIP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_178394.4
Размер кДНК:1881bp
Описание кДНК:Full length Clone DNA of Mus musculus janus kinase and microtubule interacting protein 1.
Синоним гена:Gababrbp, Marlin-1, 5830437M04Rik, C330021K24Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51374-ACGRBS16760
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51374-ACRRBS16760
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51374-ANGRBS16760
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51374-ANRRBS16760
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51374-CFRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51374-CHRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51374-CMRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51374-CYRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51374-NFRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51374-NHRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51374-NMRBS14710
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51374-NYRBS14710
Мышь JAKMIP1 Джин клон кДНК в вектор клонированияMG51374-URBS5130
Мышь JAKMIP1 Джин ORF экспрессии кДНК клона плазмидыMG51374-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51374-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».