After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ITGA9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133721.2
Размер кДНК:3111bp
Описание кДНК:Full length Clone DNA of Mus musculus integrin alpha 9, transcript variant 1 with N terminal Myc tag.
Синоним гена:(alpha)9, D130073C02, D9Ertd428e, 2610002H11Rik, Itga9
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50216-ACGRBS22240
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50216-ACRRBS22240
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50216-CFRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50216-CHRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50216-CMRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50216-CYRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин клон кДНК в вектор клонированияMG50216-MRBS5130
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50216-NFRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50216-NHRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50216-NMRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50216-NYRBS20190
Мышь Integrin alpha 9/ITGA9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыMG50216-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50216-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».