Быстрый заказ

Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ITGA8 Информация о продукте «Клон cDNA»
Размер кДНК:3186bp
Описание кДНК:Full length Clone DNA of Mus musculus integrin alpha 8 with N terminal Myc tag.
Синоним гена:AI447669, Itga8
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50211-ACGRBS22240
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50211-ACRRBS22240
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50211-CFRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50211-CHRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50211-CMRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50211-CYRBS20190
Мышь Integrin alpha 8/ITGA8 Джин клон кДНК в вектор клонированияMG50211-MRBS5130
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50211-NFRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50211-NHRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50211-NMRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50211-NYRBS20190
Мышь Integrin alpha 8/ITGA8 Джин ORF экспрессии кДНК клона плазмидыMG50211-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50211-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.