Быстрый заказ

Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь ITGA5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010577.2
Размер кДНК:3162bp
Описание кДНК:Full length Clone DNA of Mus musculus integrin alpha 5 (fibronectin receptor alpha) with N terminal His tag.
Синоним гена:Fnra, Cd49e, Itga5
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGA5 qPCR primers for gene expression analysis, MP200163 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50133-ACGRBS22240
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50133-ACRRBS22240
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50133-CFRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50133-CHRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50133-CMRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50133-CYRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин клон кДНК в вектор клонированияMG50133-MRBS5130
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50133-NFRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50133-NHRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50133-NMRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50133-NYRBS20190
Мышь Integrin alpha 5/CD49e/ITGA5 Джин ORF экспрессии кДНК клона плазмидыMG50133-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50133-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».