Быстрый заказ

Text Size:AAA

Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IVNS1ABP Информация о продукте «Клон cDNA»
Размер кДНК:1929bp
Описание кДНК:Full length Clone DNA of Mus musculus influenza virus NS1A binding protein with N terminal Myc tag.
Синоним гена:ND1, NS-1, Nd1-L, Nd1-S, NS1-BP, HSPC068, AA960440, mKIAA0850, 1190004M08Rik, 1700126I16Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52598-ACGRBS16760
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52598-ACRRBS16760
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52598-ANGRBS16760
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52598-ANRRBS16760
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52598-CFRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52598-CHRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52598-CMRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52598-CYRBS14710
Мышь IVNS1ABP Джин клон кДНК в вектор клонированияMG52598-GRBS5130
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52598-NFRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52598-NHRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52598-NMRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52598-NYRBS14710
Мышь IVNS1ABP Джин ORF экспрессии кДНК клона плазмидыMG52598-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52598-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.