IVD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52067-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IVD Reagents

CRO Services

Product recommended


All IVD Reagents

IVD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse isovaleryl coenzyme A dehydrogenase

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IVD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

1300016K07Rik cDNA ORF Clone, Mouse;6720455E18Rik cDNA ORF Clone, Mouse;AI463340 cDNA ORF Clone, Mouse

IVD Background Information

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.
Full Name
isovaleryl-CoA dehydrogenase
References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • IVD cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IVD cDNA ORF Clone in Cloning Vector, Mouse MG52067-U
    IVD cDNA ORF Clone, Mouse, untagged MG52067-UT
    IVD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52067-ACGLN
    IVD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52067-ACG
    IVD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52067-ANG
    IVD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52067-ACR
    IVD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52067-ANR
    IVD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52067-NF
    IVD cDNA ORF Clone, Mouse, C-His tag MG52067-CH
    IVD cDNA ORF Clone, Mouse, N-His tag MG52067-NH
    IVD cDNA ORF Clone, Mouse, C-HA tag MG52067-CY
    IVD cDNA ORF Clone, Mouse, N-HA tag MG52067-NY
    IVD cDNA ORF Clone, Mouse, C-Myc tag MG52067-CM
    IVD cDNA ORF Clone, Mouse, N-Myc tag MG52067-NM
    IVD qPCR Primer Pairs, Mouse MP201940

    IVD cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IVD cDNA ORF Clone in Cloning Vector, Human HG14206-G
    IVD cDNA ORF Clone, Human, untagged HG14206-UT
    IVD cDNA ORF Clone, Human, C-GFPSpark® tag HG14206-ACG
    IVD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14206-ACGLN
    IVD cDNA ORF Clone, Human, N-GFPSpark® tag HG14206-ANG
    IVD cDNA ORF Clone, Human, C-OFPSpark® tag HG14206-ACR
    IVD cDNA ORF Clone, Human, N-OFPSpark® tag HG14206-ANR
    IVD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14206-CF
    IVD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14206-NF
    IVD cDNA ORF Clone, Human, C-His tag HG14206-CH
    IVD cDNA ORF Clone, Human, N-His tag HG14206-NH
    IVD cDNA ORF Clone, Human, C-HA tag HG14206-CY
    IVD cDNA ORF Clone, Human, N-HA tag HG14206-NY
    IVD cDNA ORF Clone, Human, C-Myc tag HG14206-CM
    IVD cDNA ORF Clone, Human, N-Myc tag HG14206-NM
    IVD qPCR Primer Pairs, Human HP102856
    info info
    添加购物车成功! 添加购物车失败!