After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IST1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009888.3
Размер кДНК:1089 bp
Описание кДНК:Full length Clone DNA of Mus musculus increased sodium tolerance 1 homolog (yeast)
Синоним гена:2400003C14Rik,AW536298,mKIAA0174
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51383-ACGRBS15396
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51383-ACRRBS15396
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51383-ANGRBS15396
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51383-ANRRBS15396
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51383-CFRBS5132
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51383-CHRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51383-CMRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51383-CYRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51383-NFRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51383-NHRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51383-NMRBS13343
Мышь IST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51383-NYRBS13343
Мышь IST1 Джин клон кДНК в вектор клонированияMG51383-URBS5132
Мышь IST1 Джин ORF экспрессии кДНК клона плазмидыMG51383-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51383-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».