After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IRX4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_018885.2
Размер кДНК:1548bp
Описание кДНК:Full length Clone DNA of Mus musculus Iroquois related homeobox 4 (Drosophila) with N terminal His tag.
Синоним гена:Irx4
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51400-ACGRBS16760
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51400-ACRRBS16760
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51400-ANGRBS16760
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51400-ANRRBS16760
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51400-CFRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51400-CHRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51400-CMRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51400-CYRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51400-NFRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51400-NHRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51400-NMRBS14710
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51400-NYRBS14710
Мышь IRX4 Джин клон кДНК в вектор клонированияMG51400-URBS5130
Мышь IRX4 Джин ORF экспрессии кДНК клона плазмидыMG51400-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51400-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».