Быстрый заказ

Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse INSR Информация о продукте «Клон cDNA»
Размер кДНК:4119bp
Описание кДНК:Full length Clone DNA of Mus musculus insulin receptor with N terminal Flag tag.
Синоним гена:IR, IR-A, IR-B, CD220, 4932439J01Rik, D630014A15Rik, Insr
Участок рестрикции:HindIII + XbaI (6kb + 4.2kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2076A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse INSR Gene Plasmid Map
Mouse INSR natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51062-ACGRBS25660
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51062-ACRRBS25660
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51062-CFRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51062-CHRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51062-CMRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51062-CYRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин клон кДНК в вектор клонированияMG51062-GRBS5130
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51062-NFRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51062-NHRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51062-NMRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51062-NYRBS23610
Мышь Insulin Receptor/INSR/CD220 Джин ORF экспрессии кДНК клона плазмидыMG51062-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
Каталог: MG51062-NF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Mouse INSR natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.