After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008371.4
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 7 with N terminal Myc tag.
Синоним гена:Il-7, hlb368, MGC129342, A630026I06Rik
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50217-ACGRBS15400
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50217-ACRRBS15400
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50217-CFRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50217-CHRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50217-CMRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50217-CYRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин клон кДНК в вектор клонированияMG50217-MRBS5130
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмидыMG50217-M-NRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50217-NFRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50217-NHRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50217-NMRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50217-NYRBS13340
Мышь IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмидыMG50217-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

Ссылки
  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».