Быстрый заказ

Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL6ST Информация о продукте «Клон cDNA»
Размер кДНК:2754bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 6 signal transducer with N terminal His tag.
Синоним гена:CD130, gp130, AA389424, BB405851, D13Ertd699e, 5133400A03Rik, Il6st
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50135-ACGRBS22240
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50135-ACRRBS22240
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50135-CFRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50135-CHRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50135-CMRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50135-CYRBS20190
Мышь IL6ST/gp130/CD130 Джин клон кДНК в вектор клонированияMG50135-MRBS5130
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50135-M-YRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50135-NFRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50135-NHRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50135-NMRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50135-NYRBS20190
Мышь IL6ST/gp130/CD130 Джин ORF экспрессии кДНК клона плазмидыMG50135-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD130/gp130 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD130/gp130 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD130/gp130 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission. CD130/gp130 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD130/gp130 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.

  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
  • Size / Price
    Каталог: MG50135-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.