After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL6R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010559.2
Размер кДНК:1383bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 6 receptor, alpha.
Синоним гена:Apn, Cd13, Lap-1, Lap1, p150
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:pCMV3-mIL6RA
Участок рестрикции:KpnI + XbaI (6.1kb + 1.38kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL6R Gene Plasmid Map
Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50280-ACGRBS15400
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50280-ACRRBS15400
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50280-CFRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50280-CHRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50280-CMRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50280-CYRBS13340
Мышь IL6R/IL-6R/CD126 Джин клон кДНК в вектор клонированияMG50280-MRBS5130
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50280-NFRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50280-NHRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50280-NMRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50280-NYRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмидыMG50280-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Ссылки
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • Size / Price
    Каталог: MG50280-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».