Быстрый заказ

Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды

  • Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь IL6R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010559.2
Размер кДНК:1383bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 6 receptor, alpha.
Синоним гена:Apn, Cd13, Lap-1, Lap1, p150
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:pCMV3-mIL6RA
Участок рестрикции:KpnI + XbaI (6.1kb + 1.38kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL6R qPCR primers for gene expression analysis, MP200304 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь IL6R Gene Plasmid Map
Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50280-ACGRBS15400
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50280-ACRRBS15400
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50280-CFRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50280-CHRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50280-CMRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50280-CYRBS13340
Мышь IL6R/IL-6R/CD126 Джин клон кДНК в вектор клонированияMG50280-MRBS5130
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50280-NFRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50280-NHRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50280-NMRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50280-NYRBS13340
Мышь IL6R/IL-6R/CD126 Джин ORF экспрессии кДНК клона плазмидыMG50280-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».