After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010558.1
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 5 with N terminal Flag tag.
Синоним гена:IL-5
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-mIL5
Участок рестрикции:KpnI + XbaI (6kb + 0.43kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL5 Gene Plasmid Map
Mouse IL5 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51068-ACGRBS15396
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51068-ACRRBS15396
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51068-CFRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51068-CHRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51068-CMRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51068-CYRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин клон кДНК в вектор клонированияMG51068-GRBS5132
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51068-NFRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51068-NHRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51068-NMRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51068-NYRBS13343
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмидыMG51068-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

Ссылки
  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    Каталог: MG51068-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse IL5 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».