Быстрый заказ

Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь IL5 Информация о продукте «Клон cDNA»
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 5 with C terminal His tag.
Синоним гена:IL-5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with IL5 qPCR primers for gene expression analysis, MP201023 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51068-ACGRBS15400
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51068-ACRRBS15400
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51068-CFRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51068-CHRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51068-CMRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51068-CYRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин клон кДНК в вектор клонированияMG51068-GRBS5130
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51068-NFRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51068-NHRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51068-NMRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51068-NYRBS13340
Мышь IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмидыMG51068-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    Каталог: MG51068-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.