Быстрый заказ

Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL4 Информация о продукте «Клон cDNA»
Размер кДНК:423bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 4 with C terminal His tag.
Синоним гена:IL-4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51084-ACGRBS15400
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51084-ACRRBS15400
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51084-CFRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51084-CHRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51084-CMRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51084-CYRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин клон кДНК в вектор клонированияMG51084-GRBS5130
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51084-NFRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51084-NHRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51084-NMRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51084-NYRBS13340
Мышь IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмидыMG51084-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • Size / Price
    Каталог: MG51084-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.