IL36 gamma cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

IL36 gamma cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Mouse interleukin 1 family, member 9 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL36 gamma cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

Il1f9 cDNA ORF Clone, Mouse; IL36g cDNA ORF Clone, Mouse

IL36 gamma Background Information

Full Name
interleukin 36, gamma
References
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait