Быстрый заказ

Мышь IL36G Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь IL36G Информация о продукте «Клон cDNA»
    Размер кДНК:495bp
    Описание кДНК:Full length Clone DNA of Mus musculus interleukin 1 family, member 9 with C terminal HA tag.
    Синоним гена:IL1F9
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with IL36G qPCR primers for gene expression analysis, MP200317 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь IL36G Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Product nameProduct name
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Size / Price
    Каталог: MG51179-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.