Быстрый заказ

Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь IL36B Информация о продукте «Клон cDNA»
Размер кДНК:552bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 1 family, member 8 with N terminal Flag tag.
Синоним гена:2310043N20Rik
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
( We provide with IL36B qPCR primers for gene expression analysis, MP201026 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51071-ACGRBS15400
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51071-ACRRBS15400
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51071-CFRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51071-CHRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51071-CMRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51071-CYRBS13340
Мышь IL36B/IL1F8 Джин клон кДНК в вектор клонированияMG51071-GRBS5130
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51071-NFRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51071-NHRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51071-NMRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51071-NYRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмидыMG51071-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Каталог: MG51071-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.