After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL36B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027163.4
Размер кДНК:552bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 1 family, member 8 with C terminal His tag.
Синоним гена:2310043N20Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51071-ACGRBS15400
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51071-ACRRBS15400
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51071-CFRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51071-CHRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51071-CMRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51071-CYRBS13340
Мышь IL36B/IL1F8 Джин клон кДНК в вектор клонированияMG51071-GRBS5130
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51071-NFRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51071-NHRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51071-NMRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51071-NYRBS13340
Мышь IL36B/IL1F8 Джин ORF экспрессии кДНК клона плазмидыMG51071-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

Ссылки
  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Каталог: MG51071-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».