Быстрый заказ

Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь IL33 Информация о продукте «Клон cDNA»
Размер кДНК:801bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 33 with N terminal His tag.
Синоним гена:Il-33, Il1f11, NF-HEV, 9230117N10Rik
Участок рестрикции:HindIII + XbaI (6kb + 0.85kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with IL33 qPCR primers for gene expression analysis, MP200148 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь IL33 Gene Plasmid Map
Mouse IL33 / NF-HEV natural ORF mammalian expression plasmid, N-His tag
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50118-ACGRBS15400
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50118-ACRRBS15400
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50118-ANGRBS15400
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50118-CFRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50118-CHRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50118-CMRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50118-CYRBS13340
Мышь IL-33 Джин клон кДНК в вектор клонированияMG50118-MRBS5130
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50118-NFRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50118-NHRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50118-NMRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50118-NYRBS13340
Мышь IL-33 Джин ORF экспрессии кДНК клона плазмидыMG50118-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.
  • Size / Price
    Каталог: MG50118-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    • Mouse IL33 / NF-HEV natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.