Быстрый заказ

Text Size:AAA

Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL2RB Информация о продукте «Клон cDNA»
Размер кДНК:1620bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 2 receptor, beta chain with N terminal Myc tag.
Синоним гена:p70, CD122, IL15Rbeta, Il-2Rbeta, MGC118674, IL-15Rbeta, Il-2/15Rbeta
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50792-ACGRBS16760
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50792-ACRRBS16760
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50792-CFRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50792-CHRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50792-CMRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50792-CYRBS14710
Мышь CD122 / IL-2RB Джин клон кДНК в вектор клонированияMG50792-GRBS5130
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50792-NFRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50792-NHRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50792-NMRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50792-NYRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмидыMG50792-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Каталог: MG50792-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.